SciCommander

This is a small tool that executes single shell commands in a scientifically more reproducible and robust way, by doing the following things:

Features

• Auditing: Creating an audit log of most output files
• Caching: Skipping executions where output files already exist

Roadmap

There are also some further features that are planned to be introduced further down the road, such as:

• Atomic writes - Writes files to a temporary location (such as a sub-folder)
  until command is finished, so that they are never placed at their final
  destination before completely finished.

News

• Sep 3, 2024: A blog post and poster about the new Go version of SciCommander
  is now published here.
• Aug 16, 2024: Version 0.4 released, which is a complete rewrite of the
  tool in Go, with some cool new features such as the ability to detect output
  files automatically.
• Nov 9, 2023: Version 0.3.3 released, with a new command, scishell, that
  allows you to run commands more like in a normal shell (only adding i:
  before input files and o: before output files), instead of running it
  through a separate command, and still have the full audit trace generated.
  • Read more in this blog post!

Requirements

• A unix like operating system such as Linux or Mac OS (On Windows you can use
  WSL or MSYS2)
• A Bash shell
• For graph plotting for the HTML report, you need
  GraphViz and its dot command.

Installation

Downloading a pre-built binary

This is the recommended option for most users.

1. Go to the Releases page
2. Identify the latest release
3. Look under the "Assets" section for a pre-built binary for your computer's
   hardware architecture and operating system. E.g. something with
   linux-amd64 in the name for 64bit Linux operating systems.
4. Download the archive
5. Unpack it
6. Put the binary in a folder that is available in your $PATH variable, such
   as /usr/bin, or even better ~/bin, if you make sure that the latter is
   included in $PATH (If not, you can add export PATH=~/bin:$PATH e.g. to
   the end of your ~/.bashrc file and then restart your shell).
7. Done. Now you should be able to execute the sci command in any newly
   opened bash shell.

Using Go

This method assumes that you have installed the Go toolchain.

go install github.com/samuell/scicommander/cmd/sci@latest

This will install the sci command into your PATH variable, so that it should be executable from your shell.

(Other installation options to be added shortly)

Usage

To view the options of the sci command, execute:

sci -h

To get the benefits from SciCommander, do the following:

1. Prepend all your shell commands with the sci run command.
2. Wrap the command itself in quotes, either "" or ''. This is not strictly
   required always, but will be required for example if using redirection using
   > or piping with | (Alternatively one can just add quotes around those).
3. Then run your script as usual.

Now you will notice that if you run your script again, it will skip all commands that have already finished and produced output files.

You will also have files with the extension .au for every output that you decorated with the syntax above.

To convert such an audit report into a nice HTML-report, you can run the following:

sci to-html <audit-file>

Example

To demonstrate how you can use SciCommander, imagine that you want to write the following little toy bioinformatics pipeline, that writes some DNA and converts its reverse complement, as a shell script, my_pipeline.sh:

#!/bin/bash

# Create a fasta file with some DNA
echo AAAGCCCGTGGGGGACCTGTTC > dna.fa
# Compute the complement sequence
cat dna.fa | tr ACGT TGCA > dna.compl.fa
# Reverse the DNA string
cat dna.compl.fa | rev > dna.compl.rev.fa

Now, to make the commands run through SciCommander, change the syntax in the script like this:

#!/bin/bash

# Create a fasta file with some DNA
sci run echo AAAGCCCGTGGGGGACCTGTTC '>' dna.fa
# Compute the complement sequence
sci run cat dna.fa '|' tr ACGT TGCA '>' dna.compl.fa
# Reverse the DNA string
sci run cat dna.compl.fa '|' rev '>' dna.compl.rev.fa

Notice that we had to wrap all pipe characters (|) and redirection characters (>) in quotes. This is so that they are not grabbed by bash immediately but instead passed with the command to SciCommander, and executed as part of its execution.

An alternative is to encapsulate the full commands in '':

#!/bin/bash

# Create a fasta file with some DNA
sci run 'echo AAAGCCCGTGGGGGACCTGTTC > dna.fa'
# Compute the complement sequence
sci run 'cat dna.fa | tr ACGT TGCA > dna.compl.fa'
# Reverse the DNA string
sci run 'cat dna.compl.fa | rev > dna.compl.rev.fa'

Now you can run the script as usual, e.g. with:

bash my_pipeline.sh

Now, the files in your folder will look like this, if you list them with ls -tr:

my_pipeline.sh
dna.fa.au
dna.fa
dna.compl.fa.au
dna.compl.fa
dna.compl.rev.fa.au
dna.compl.rev.fa

Now, you see that the last .au file is dna.compl.rev.fa.au.

To convert this file to HTML and view it in a browser, you can do:

sci to-html dna.compl.rev.fa.au

Experimental: Bash integration

There is experimental support for running SciCommander commands in bash, without needing to run them via the sci run command.

To do this, start the SciCommander shell with the following command:

sci shell

And then, you can run the example commands above as follows:

# Create a fasta file with some DNA
echo AAAGCCCGTGGGGGACCTGTTC > dna.fa
# Compute the complement sequence
cat dna.fa | tr ACGT TGCA > dna.compl.fa
# Reverse the DNA string
cat dna.compl.fa | rev > dna.compl.rev.fa

In other words, no extra syntax is needed.

Notes

[1] Although Nextflow and Snakemake already take care of some of the benefits, such as atomic writes, SciCommander adds additional features such as detailed per-output audit logs. It can thus be a great complement to these tools.